Review



s cerevisiae w303 1a strain  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    ATCC s cerevisiae w303 1a strain
    S Cerevisiae W303 1a Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 84 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+cerevisiae+strain+w303+1a/Saccharomyces+cerevisiae%3B+W303-1a/pm39749973-43-0-11
    Average 94 stars, based on 84 article reviews
    s cerevisiae w303 1a strain - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Identification of a novel Fasciola hepatica cathepsin L protease containing protective epitopes within the propeptide.
    Article Snippet: Cathepsin L (CL)-like proteases are important candidate vaccine antigens for protection against helminth infections.. We previously identified an immunogenic 32 kDa protein specifically present in newly excysted juveniles (NEJs) of Fasciola hepatica.. Here we show by N-terminal protein sequencing that this protein represents a CL-like protease still containing the propeptide.

    Article Title: Surface-engineered Saccharomyces cerevisiae displaying α-acetolactate decarboxylase from Acetobacter aceti ssp xylinum.
    Article Snippet: Objectives To convert a-acetolactate into acetoin by an a-acetolactate decarboxylase (ALDC) to prevent its conversion into diacetyl that gives beer an unfavourable buttery flavour.. Results We constructed a whole Saccharomyces cerevisiae cell catalyst with a truncated active ALDC from Acetobacter aceti ssp xylinum attached to the cell wall using the C-terminal anchoring domain of aagglutinin.. ALDC variants in which 43 and 69 Nterminal residues were absent performed equally well and had significantly decreased amounts of diacetyl during fermentation.

    Article Title: Efficient bacterial expression of fusion proteins and their selective processing by a recombinant Kex-1 protease.
    Article Snippet: A secreted, soluble variant of the Kex-1 endopeptidase from Kluyveromyces lactis has been produced and studied as a novel cleavage enzyme exhibiting high specificity for the Lys-Arg peptide.. This highly selective, efficient enzyme is particularly adapted for use in manufacturing when a recombinant therapeutic protein, possessing its native N-terminus, has to be released in vitro from a bacterially-expressed fusion protein.. In this paper, we describe the preparation of a Kex-1 variant using Saccharomyces cerevisiae and its application in the production of important therapeutic recombinant proteins such as human growth hormone, granulocyte colony-stimulating factor and interferon-a-2b.

    other:

    Article Title: Heterologous expression of glycerol 3-phosphate dehydrogenase gene () and glycerol dehydrogenase gene () in
    Article Snippet: S. cerevisiae strain YSH642 (gpd1v : :TRP1 gpd2v : : URA, derived from strain W303 1-A, a gift from Dr. Stefan Hohmann, Go«teborg University, Sweden) was cultivated in Leu-dropout medium (0.67% (w/v) yeast nitrogen base without amino acids, 0.69% (w/v) CSM-Leu powder (Sigma)) containing 2% (w/v) ra⁄nose at 30‡C with shaking.

    Article Title: Exploiting the endogenous yeast nuclear proteome to identify short linear motifs in vivo
    Article Snippet: S. cerevisiae: strain W303-1A , ATCC , 208352.

    Mutagenesis:

    Article Title: The replacement of ergosterol with alternative sterols affects the physiological function of the yeast plasma membrane, including its H + -ATPase activity and resistance to antifungal drugs.
    Article Snippet: Sterols perform essential structural and signalling functions in living organisms.. Ergosterol contributes to the fluidity, permeability, microdomain formation and functionality of proteins in the yeast membrane.. In our study, desmosterol was the most successful at compensating for the lack of ergosterol in Saccharomyces cerevisiae, besides stigmasterol and sitosterol.

    Construct:

    Article Title: Surface-engineered Saccharomyces cerevisiae displaying α-acetolactate decarboxylase from Acetobacter aceti ssp xylinum.
    Article Snippet: Objectives To convert a-acetolactate into acetoin by an a-acetolactate decarboxylase (ALDC) to prevent its conversion into diacetyl that gives beer an unfavourable buttery flavour.. Results We constructed a whole Saccharomyces cerevisiae cell catalyst with a truncated active ALDC from Acetobacter aceti ssp xylinum attached to the cell wall using the C-terminal anchoring domain of aagglutinin.. ALDC variants in which 43 and 69 Nterminal residues were absent performed equally well and had significantly decreased amounts of diacetyl during fermentation.

    Expressing:

    Article Title: Surface-engineered Saccharomyces cerevisiae displaying α-acetolactate decarboxylase from Acetobacter aceti ssp xylinum.
    Article Snippet: Objectives To convert a-acetolactate into acetoin by an a-acetolactate decarboxylase (ALDC) to prevent its conversion into diacetyl that gives beer an unfavourable buttery flavour.. Results We constructed a whole Saccharomyces cerevisiae cell catalyst with a truncated active ALDC from Acetobacter aceti ssp xylinum attached to the cell wall using the C-terminal anchoring domain of aagglutinin.. ALDC variants in which 43 and 69 Nterminal residues were absent performed equally well and had significantly decreased amounts of diacetyl during fermentation.

    Article Title: Efficient bacterial expression of fusion proteins and their selective processing by a recombinant Kex-1 protease.
    Article Snippet: A secreted, soluble variant of the Kex-1 endopeptidase from Kluyveromyces lactis has been produced and studied as a novel cleavage enzyme exhibiting high specificity for the Lys-Arg peptide.. This highly selective, efficient enzyme is particularly adapted for use in manufacturing when a recombinant therapeutic protein, possessing its native N-terminus, has to be released in vitro from a bacterially-expressed fusion protein.. In this paper, we describe the preparation of a Kex-1 variant using Saccharomyces cerevisiae and its application in the production of important therapeutic recombinant proteins such as human growth hormone, granulocyte colony-stimulating factor and interferon-a-2b.

    Purification:

    Article Title: Efficient bacterial expression of fusion proteins and their selective processing by a recombinant Kex-1 protease.
    Article Snippet: A secreted, soluble variant of the Kex-1 endopeptidase from Kluyveromyces lactis has been produced and studied as a novel cleavage enzyme exhibiting high specificity for the Lys-Arg peptide.. This highly selective, efficient enzyme is particularly adapted for use in manufacturing when a recombinant therapeutic protein, possessing its native N-terminus, has to be released in vitro from a bacterially-expressed fusion protein.. In this paper, we describe the preparation of a Kex-1 variant using Saccharomyces cerevisiae and its application in the production of important therapeutic recombinant proteins such as human growth hormone, granulocyte colony-stimulating factor and interferon-a-2b.

    Transformation Assay:

    Article Title: Efficient bacterial expression of fusion proteins and their selective processing by a recombinant Kex-1 protease.
    Article Snippet: A secreted, soluble variant of the Kex-1 endopeptidase from Kluyveromyces lactis has been produced and studied as a novel cleavage enzyme exhibiting high specificity for the Lys-Arg peptide.. This highly selective, efficient enzyme is particularly adapted for use in manufacturing when a recombinant therapeutic protein, possessing its native N-terminus, has to be released in vitro from a bacterially-expressed fusion protein.. In this paper, we describe the preparation of a Kex-1 variant using Saccharomyces cerevisiae and its application in the production of important therapeutic recombinant proteins such as human growth hormone, granulocyte colony-stimulating factor and interferon-a-2b.



    Similar Products

    94
    ATCC s cerevisiae w303 1a strain
    S Cerevisiae W303 1a Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+cerevisiae+strain+w303+1a/Saccharomyces+cerevisiae%3B+W303-1a/pm39749973-43-0-11
    Average 94 stars, based on 1 article reviews
    s cerevisiae w303 1a strain - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    95
    ATCC budding yeast s cerevisiae atcc 208352 strain w303 1a
    Budding Yeast S Cerevisiae Atcc 208352 Strain W303 1a, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+cerevisiae+strain+w303+1a/Saccharomyces+cerevisiae+Meyen+ex+E%2EC%2E+Hansen/pm39531032-229-8-12
    Average 95 stars, based on 1 article reviews
    budding yeast s cerevisiae atcc 208352 strain w303 1a - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    94
    ATCC s cerevisiae strain w303 1a
    S Cerevisiae Strain W303 1a, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+cerevisiae+strain+w303+1a/Flexibacter+elegans+Soriano/pm39187062-69-0-32
    Average 94 stars, based on 1 article reviews
    s cerevisiae strain w303 1a - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    ATCC s cerevisiae strains
    S Cerevisiae Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+cerevisiae+strain+w303+1a/Saccharomyces+cerevisiae%3B+W303-1a/pm39178861-244-25-22
    Average 94 stars, based on 1 article reviews
    s cerevisiae strains - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    ATCC mya 3332 s cerevisiae strain w303 1a atcc 208352 oligonucleotides nhs ultramer tgaagggctggcggttggggttat tcgcaacggcgactggctggaattctctggatca
    Mya 3332 S Cerevisiae Strain W303 1a Atcc 208352 Oligonucleotides Nhs Ultramer Tgaagggctggcggttggggttat Tcgcaacggcgactggctggaattctctggatca, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+cerevisiae+strain+w303+1a/Saccharomyces+cerevisiae+Meyen+ex+E%2EC%2E+Hansen/pm37949066-176-177-182
    Average 94 stars, based on 1 article reviews
    mya 3332 s cerevisiae strain w303 1a atcc 208352 oligonucleotides nhs ultramer tgaagggctggcggttggggttat tcgcaacggcgactggctggaattctctggatca - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    95
    ATCC s cerevisiae strain w303 1a atcc208352
    S Cerevisiae Strain W303 1a Atcc208352, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/s+cerevisiae+strain+w303+1a/Saccharomyces+cerevisiae+Meyen+ex+E%2EC%2E+Hansen/us11702627-174-309-318
    Average 95 stars, based on 1 article reviews
    s cerevisiae strain w303 1a atcc208352 - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results